header

genetic-algorithms.com

 

Inspect guest501_0_0_21

Parents

guest501_0_0_21 has no parents. It was generated at random.

guest501_0_0_21

Image 01

  • Creator: guest501
  • Population: 0
  • Generation: 0
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 06/15/2019
  • Genome: GGATTGATTGAAAGCTCAGGCACTAGTCAA
  • Function:

    numbers("yyy") if cos(numbers("yyy")) > gradient[0](numbers("yyy") if cos(numbers("yyy")) > numbers('xyy') else numbers('xry')) else numbers("yyy") if numbers('xry') > cos(numbers("yyy")) else numbers('xyy') if cos(numbers("yyy")) if numbers('xry') > numbers("yyy") else numbers('xyy') > cos(numbers("yyy")) else gradient[0](cos(numbers("yyy")) if numbers('xry') > numbers('xyy') else numbers("yyy"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest501_0_1_10

Image 01

Genome: GCCGGATTGATTATATCTTAAACTATTAGTCAA