• Creator: guest501
• Population: 0
• Generation: 1
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 06/15/2019
• Genome: GTGGTAATGCGAACCCCATAATCCGAATTAACC
• Function:

  sqrt(mod(10 *(product(numbers("xxx"), numbers('yyx'))), product(numbers("xxx"), numbers('yyx')))) if sqrt(mod(10 *(product(numbers("xxx"), numbers('yyx'))), product(numbers("xxx"), numbers('yyx')))) if product(numbers("xxx"), numbers('yyx')) > 10 *(product(numbers("xxx"), numbers('yyx'))) else mod(10 *(product(numbers("xxx"), numbers('yyx'))), product(numbers("xxx"), numbers('yyx'))) > mod(10 *(product(numbers("xxx"), numbers('yyx'))), product(numbers("xxx"), numbers('yyx'))) else 10 *(product(numbers("xxx"), numbers('yyx')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.