• Creator: guest501
• Population: 0
• Generation: 4
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 06/15/2019
• Genome: CCAACGAGCAGCATGCTGTTGGACTCCGCAGCTAGA
• Function:

  product(100 *(cos(cos(sqrt(mean(numbers('epe'), numbers("xxy")))))), cos(cos(sqrt(mean(numbers('epe'), numbers("xxy"))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.