• Creator: guest501
• Population: 0
• Generation: 6
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 06/15/2019
• Genome: AATAGTGGCACGCCTAAAGAGGATGAGAATTGT
• Function:

  noise(gradient[1](abs(numbers("xyx")) if numbers("xyx") > divide(abs(numbers("xyx")), numbers("xyx")) else 100 *(divide(abs(numbers("xyx")), numbers("xyx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.