header

genetic-algorithms.com

 

Inspect guest49_0_0_12

Parents

guest49_0_0_12 has no parents. It was generated at random.

guest49_0_0_12

Image 01

  • Creator: guest49
  • Population: 0
  • Generation: 0
  • Total Fitness: 6
  • No. Votes: 1
  • Avg. Fitness 6
  • Created: 05/19/2019
  • Genome: GCGGACGTCACCACCGCGCAGGATGGGCGA
  • Function:

    10 *(numbers('yxy')) if numbers("xyx") if numbers('yxy') > 10 *(10 *(numbers('yxy'))) else 10 *(numbers('yxy')) > numbers('yxy') else 10 *(10 *(numbers('yxy'))) if 10 *(10 *(numbers('yxy'))) > 10 *(numbers('yxy')) else numbers('yxy') if 10 *(numbers('yxy')) > 10 *(10 *(numbers('yxy'))) else numbers("xyx")

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest49_0_1_18

Image 01

Genome: GCGGACGTCATCAGTGGTGCTCAGCCAAAA