• Creator: guest616
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 07/23/2019
• Genome: GGTGATCGAACTCCACAGCGCGGATGGGCG
• Function:

  product(numbers("xyx"), numbers('xry')) if 2 *(product(numbers("xyx"), numbers('xry'))) > 2 *(product(numbers("xyx"), numbers('xry'))) if mod(2 *(product(numbers("xyx"), numbers('xry'))), product(numbers("xyx"), numbers('xry'))) > numbers("xyx") else product(numbers("xyx"), numbers('xry')) else mod(2 *(product(numbers("xyx"), numbers('xry'))), product(numbers("xyx"), numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.