• Creator: guest49
• Population: 0
• Generation: 2
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: CCGAGTTCTCTCAACACGGCCCCGGGATGGTCG
• Function:

  divide(gradient[1](square(100 *(numbers('yyx'))) if numbers('yyx') > min(square(100 *(numbers('yyx'))), 100 *(numbers('yyx'))) else 100 *(numbers('yyx'))), 100 *(numbers('yyx')) if min(square(100 *(numbers('yyx'))), 100 *(numbers('yyx'))) > numbers('yyx') else square(100 *(numbers('yyx'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.