• Creator: guest691
• Population: 0
• Generation: 1
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 08/24/2019
• Genome: GTGTGAGCAACTCTTTCGAACACAACATAT
• Function:

  2 *(round(numbers('yxy'), numbers("xxy"))) if round(numbers('yxy'), numbers("xxy")) > numbers("xxy") if numbers('yxy') > 2 *(round(numbers('yxy'), numbers("xxy"))) else round(numbers('yxy'), numbers("xxy")) else round(numbers('yxy'), numbers("xxy")) if numbers('yxy') > 2 *(round(numbers('yxy'), numbers("xxy"))) if numbers("xxy") > round(numbers('yxy'), numbers("xxy")) else numbers('yxy') else 2 *(round(numbers('yxy'), numbers("xxy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.