• Creator: guest13046
• Population: 0 (Global)
• Generation: 2
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 07/29/2024
• Genome: AGGGGAACCACCCACAAGATCTTCACCCCAGTACGG
• Function:

  tan(invert(numbers('rep')) if 10 *(10 *(sum(invert(numbers('rep')), numbers('rep')))) > sum(invert(numbers('rep')), numbers('rep')) else 10 *(sum(invert(numbers('rep')), numbers('rep'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.