• Creator: global
• Population: 0 (Global)
• Generation: 1
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 07/29/2024
• Genome: AAGTTCGCGACCATGGACTTTTATCTAACT
• Function:

  invert(numbers("xxy") if sqrt(numbers("xxy")) > numbers("xxy") if numbers('rrr') > sqrt(numbers("xxy")) else 10 *(sqrt(numbers("xxy"))) else 10 *(sqrt(numbers("xxy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.