• Creator: guest49
• Population: 0
• Generation: 5
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: AACCGGCCGCACATACCCTTATAATACCAA
• Function:

  square(exp(divide(sum(logn(numbers('yyx')), numbers('yyx')), logn(numbers('yyx'))), sum(logn(numbers('yyx')), numbers('yyx'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.