• Creator: guest49
• Population: 0
• Generation: 5
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: TGCAATCCTAGCAGTTTAGAGAAGTTGTGT
• Function:

  noise(divide(cos(gradient[1](numbers("per"))), gradient[1](numbers("per")))) if divide(cos(gradient[1](numbers("per"))), gradient[1](numbers("per"))) > cos(gradient[1](numbers("per"))) else gradient[1](numbers("per"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.