header

genetic-algorithms.com

 

Inspect guest744_0_1_28

Parents

guest744_0_1_28 has no parents. It was generated at random.

guest744_0_1_28

Image 01

  • Creator: guest744
  • Population: 0
  • Generation: 1
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 09/26/2019
  • Genome: TTCGACCAGCAAAGGCTTTGGTTCCAGAGG
  • Function:

    minus(sum(tan(numbers('rrr')), numbers('rrr')), tan(numbers('rrr'))) if tan(numbers('rrr')) > sum(tan(numbers('rrr')), numbers('rrr')) else sum(tan(numbers('rrr')), numbers('rrr')) if numbers('rrr') > tan(numbers('rrr')) else minus(sum(tan(numbers('rrr')), numbers('rrr')), tan(numbers('rrr')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest744_0_1_28 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!