header

genetic-algorithms.com

 

Inspect camrobjones_global_0_1_4

Parents

Mother

Image 01

global_global_0_0_6

Genome: CGCGAGTAGGCGTAGTCGCGGCTAGCACAT

Father

Image 01

global_global_0_0_3

Genome: CCCGATGATTTCAGAACTACAGACTACCAT

camrobjones_global_0_1_4

Image 01

  • Creator: camrobjones
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 59
  • No. Votes: 8
  • Avg. Fitness 7.4
  • Created: 05/19/2019
  • Genome: CATCGCGAGTAGGCGTAAACTACAGACGCAGAT
  • Function:

    minus(round(numbers('xyy') if numbers("xxy") if numbers('xyy') > numbers("yyy") else numbers("xxy") if numbers("yyy") > numbers("yyy") else numbers('xyy') > numbers("yyy") else numbers("yyy") if numbers("yyy") > numbers('xyy') else numbers("xxy") if numbers('xyy') if numbers("xxy") > numbers("yyy") else numbers("yyy") > numbers('xyy') else numbers("yyy") if numbers('xyy') > numbers('xyy') if numbers("xxy") > numbers("yyy") else numbers("yyy") else numbers("xxy"), numbers("yyy") if numbers('xyy') > numbers("xxy") if numbers("yyy") > numbers("yyy") else numbers('xyy') else numbers("xxy") if numbers('xyy') > numbers("yyy") if numbers("xxy") > numbers('xyy') else numbers("yyy") else numbers("yyy")), numbers("yyy") if numbers('xyy') > numbers("xxy") else numbers('xyy') if numbers("yyy") > numbers("yyy") else numbers("xxy") if numbers('xyy') if numbers("yyy") > numbers("yyy") if numbers("yyy") > numbers("xxy") else numbers('xyy') else numbers("xxy") if numbers("yyy") > numbers("yyy") else numbers('xyy') if numbers("yyy") > numbers("xxy") else numbers('xyy') > numbers('xyy') else numbers("yyy") if numbers("yyy") > numbers("xxy") else numbers('xyy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest4634_0_2_256

Image 01

Genome: TAACATCGCGAGTAGGCTTAAACGCGGTCCTCAGAT

guest203_0_2_238

Image 01

Genome: AAACATCGCGAGTAGGCTGCTCCTTCAGACGCAGAT

sina12345_0_2_103

Image 01

Genome: CATCGCGAGTAGGCGTAAACTACAAACGCAGAT

guest200_0_2_230

Image 01

Genome: CTACTCTTAATCTCGTTAGCAACAAACGCACAG

guest195_0_2_216

Image 01

Genome: GGTCTTCGCGAGTAGCCGTATCGACTGTTGTGCGAT

guest195_0_2_173

Image 01

Genome: CATCGCGTAGTCCGACGCTGAACCTGTTTAGAT

guest146_0_2_153

Image 01

Genome: GGGTCGTGGCGACACACTAGTTGTCGGGCTTCGACG

guest94_0_2_151

Image 01

Genome: CGTCCATTATCAAGCCCCAAAACTACGGACCCTGAT

sina12345_0_2_59

Image 01

Genome: TCCGCTTACACCACGTAAACAACAATTATG

guest30_0_2_19

Image 01

Genome: CGTGGAGCGTATAAGGCGTAAACAACCCTTTCG