• Creator: silverjacket
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: CGCTGGACCACAATGATCATATTAGCGGAA
• Function:

  round(gradient[2](sqrt(numbers('rep'))) if sqrt(numbers('rep')) > 10 *(gradient[2](sqrt(numbers('rep')))) else numbers('rep'), 10 *(gradient[2](sqrt(numbers('rep')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.