• Creator: lord_A_r_i
• Population: 0
• Generation: 0
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 11/23/2019
• Genome: AGACCCGCAACACGGCGCGTGCTCCGCTTA
• Function:

  sin(product(exp(numbers('xry'), numbers('epe')) if numbers('xry') > numbers('epe') else gradient[2](exp(numbers('xry'), numbers('epe'))), gradient[2](exp(numbers('xry'), numbers('epe')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.