• Creator: lord_A_r_i
• Population: 0
• Generation: 2
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 11/23/2019
• Genome: AGTGCAACCAGTAGCCGCGTCTACTCAGCA
• Function:

  gradient[1](10 *(gradient[1](cos(numbers('xry')))) if cos(numbers('xry')) > numbers('xry') else gradient[1](cos(numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.