header

genetic-algorithms.com

 

Inspect guest966_0_0_2

Parents

guest966_0_0_2 has no parents. It was generated at random.

guest966_0_0_2

Image 01

  • Creator: guest966
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/05/2019
  • Genome: TCGATCCCCTACTTCGAGAATCAATTTCTA
  • Function:

    band pass(product(numbers("yxx") if numbers("xxx") if numbers("yxx") > numbers('rrr') else numbers("xyx") > numbers("xyx") else numbers("xxx"), numbers('rrr') if numbers("yxx") > numbers("xyx") else numbers("xxx"))) if product(numbers("xyx") if numbers("xxx") if numbers("yxx") > numbers('rrr') else numbers("xyx") > numbers("xxx") else numbers("yxx"), numbers("xxx") if numbers("yxx") > numbers("xyx") else numbers('rrr')) > numbers("yxx") if numbers('rrr') > numbers("xxx") else numbers("xyx") else numbers("yxx") if numbers("xxx") if numbers('rrr') > numbers("yxx") else numbers("xyx") > numbers("xyx") else numbers("xxx")

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest966_0_1_1

Image 01

Genome: AGTGCCTCGTTAGCATAGAATCAATTTGTT