• Creator: guest966
• Population: 0
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/05/2019
• Genome: AAGCTTTAGACTACGACACATAGACACGCG
• Function:

  invert(round(2 *(100 *(numbers("yyy"))) if 100 *(numbers("yyy")) > numbers("yyy") else numbers("yxx"), 2 *(100 *(numbers("yyy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.