header

genetic-algorithms.com

 

Inspect guest966_0_0_17

Parents

guest966_0_0_17 has no parents. It was generated at random.

guest966_0_0_17

Image 01

  • Creator: guest966
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/05/2019
  • Genome: TCCGCAGAGAGATCTGGTGATAATGACCTG
  • Function:

    sin(numbers("xxy") if numbers("yxx") > numbers('ryy') else numbers("yxx")) if numbers("yxx") if numbers("xxy") if numbers("yxx") > numbers("yxx") else numbers('ryy') > numbers('ryy') else sin(numbers("xxy") if numbers("yxx") > numbers('ryy') else numbers("yxx")) > numbers("yxx") if numbers('ryy') > numbers("yxx") else numbers("xxy") else numbers('ryy') if numbers("yxx") > numbers("yxx") else numbers("xxy") if sin(numbers("yxx") if numbers("yxx") > numbers("xxy") else numbers('ryy')) if numbers('ryy') if numbers("xxy") > numbers("yxx") else numbers("yxx") > numbers('ryy') else numbers("yxx") > sin(numbers("yxx") if numbers("yxx") > numbers('ryy') else numbers("xxy")) else numbers('ryy')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest966_0_1_19

Image 01

Genome: CCCGCAGTGAGATCTGGTGATAACGCCCTG

guest966_0_1_19

Image 01

Genome: CCCGCAGTGAGATCTGGTGATAACGCCCTG

guest966_0_1_17

Image 01

Genome: AGGCAGCTTGTATCTGCTGTAGTACTGCCT

guest966_0_1_14

Image 01

Genome: CTACCGTTGGATACTACCGGTGATACTGACCCC