header

genetic-algorithms.com

 

Inspect Jade_0_0_0

Parents

Jade_0_0_0 has no parents. It was generated at random.

Jade_0_0_0

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/05/2019
  • Genome: GACACTAAATGGTAGAATTGGTCTTTTAAC
  • Function:

    numbers('xyy') if numbers('yxr') > numbers('yxr') if numbers('xyy') > numbers('rrr') else numbers("yxx") else numbers("yxx") if abs(numbers('yxr') if numbers("yxx") > numbers('rrr') else numbers('xyy') if numbers('yxr') > numbers("yxx") else numbers('xyy')) > numbers('yxr') if numbers('rrr') > numbers('xyy') else numbers("yxx") else 2 *(abs(numbers("yxx") if numbers("yxx") if numbers('rrr') > numbers('yxr') else numbers('xyy') > numbers('xyy') else numbers('yxr')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_1_20

Image 01

Genome: AACCTGATCCTTTTAGCCTCCTGGCGTATC

Jade_0_1_15

Image 01

Genome: TACACTAATTGGTAGAGTTAGTCTCGAGCC

Jade_0_1_9

Image 01

Genome: AGTACGACGGAAAAGCCAAACTGGACTGACTGT

Jade_0_1_6

Image 01

Genome: CCCACGGAATGGTAGAAGTGGCCTATTAAC