• Creator: Jade
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 12/05/2019
• Genome: AGCACTGCGACTCATTCTGCCCGGCTAGAA
• Function:

  cos(2 *(numbers('yyx') if numbers('xyy') > minus(numbers('xyy'), numbers('yyx')) else 2 *(minus(numbers('xyy'), numbers('yyx')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.