• Creator: Jade
• Population: 0
• Generation: 1
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 12/05/2019
• Genome: ATGACAGCTTTCAAAACCTCTGAGTCTGGTTCC
• Function:

  sqrt(gradient[2](abs(10 *(numbers('xyy'))) if numbers('xyy') > abs(10 *(numbers('xyy'))) if numbers('xyy') > 10 *(numbers('xyy')) else numbers("xyx") else 10 *(numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.