• Creator: Jade
• Population: 0
• Generation: 1
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 12/05/2019
• Genome: TAAAGATCAAATACCTCTGAGCAACGAGCG
• Function:

  noise(10 *(numbers('xyy'))) if 10 *(numbers('xyy')) > numbers('xyy') if 10 *(numbers('xyy')) > numbers("xyx") else noise(10 *(numbers('xyy'))) else sin(numbers("xyx") if 10 *(numbers('xyy')) > numbers('xyy') else noise(10 *(numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.