• Creator: Jade
• Population: 0
• Generation: 1
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 12/05/2019
• Genome: TAAAGATCAAATACCTCTGAGCAACGAGCG
• Function:

  numbers('xyy') if numbers("xyx") > 10 *(numbers('xyy')) else noise(10 *(numbers('xyy'))) if noise(10 *(numbers('xyy'))) > sin(numbers('xyy') if numbers("xyx") > 10 *(numbers('xyy')) else noise(10 *(numbers('xyy')))) else 10 *(numbers('xyy'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.