header

genetic-algorithms.com

 

Inspect Jade_0_3_1

Parents

Mother

Image 01

Jade_0_2_3

Genome: TAAACGAGGAGCTTTTATAAGTGTGTGTTTTGA

Father

Image 01

Jade_0_2_8

Genome: TCACTCGTCGCATCGCGTTGCTCCTTTAAATAC

Jade_0_3_1

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 3
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/05/2019
  • Genome: TAAGCGAGGAGCTGTTAGAAGTGTTTTAAAGGA
  • Function:

    numbers("xyx") if numbers('ryy') > numbers("xxx") if numbers("xyx") > numbers('ryy') else numbers('rrr') else numbers('rrr') if cos(numbers('rrr') if numbers("xyx") if numbers("xxx") > numbers('ryy') else numbers('rrr') > numbers('ryy') else numbers("xyx")) > tan(cos(numbers("xyx") if numbers('rrr') > numbers('ryy') else numbers("xxx") if numbers("xyx") > numbers('rrr') else numbers('ryy'))) else numbers("xxx") if numbers('rrr') > numbers("xyx") else numbers('ryy') if numbers('ryy') if numbers("xyx") > numbers("xxx") if numbers("xyx") > numbers('rrr') else numbers('ryy') else numbers('rrr') > cos(numbers("xyx") if numbers('rrr') > numbers("xyx") if numbers('ryy') > numbers("xxx") else numbers('rrr') else numbers('ryy')) else tan(cos(numbers('rrr') if numbers("xyx") > numbers("xyx") if numbers('ryy') > numbers('rrr') else numbers("xxx") else numbers('ryy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_4_12

Image 01

Genome: CTGTAAGCGAGGAGCTGTTAGAAGTGTTTTAAAGGA

Jade_0_4_20

Image 01

Genome: GACGCCTTAGGCTGTTAGAAGTGTTTCAAT

Jade_0_4_7

Image 01

Genome: ATCTCCAGGAGCAGTTAGAAGTGTTGATCA

Jade_0_4_6

Image 01

Genome: TAGCATATCGTCGCCTAGTATGCACCCATAGGA

Jade_0_4_0

Image 01

Genome: TACTCTTATATCCTTTAGAAGTGTCCAGAC