header

genetic-algorithms.com

 

Inspect Jade_0_3_14

Parents

Mother

Image 01

Jade_0_2_28

Genome: AGAACCCTAAACCGTCCTGCACCCTTCTGA

Father

Image 01

Jade_0_2_2

Genome: TGAAGATCAAAGACCTCTGAGGTAATTGCG

Jade_0_3_14

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 3
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 12/05/2019
  • Genome: GGAACCCAGAAACGTTCTGAACCCTTCTGA
  • Function:

    minus(abs(log(numbers('xyy'), numbers("xxx"))), log(numbers('xyy'), numbers("xxx"))) if 10 *(minus(abs(log(numbers('xyy'), numbers("xxx"))), log(numbers('xyy'), numbers("xxx")))) > abs(log(numbers('xyy'), numbers("xxx"))) else log(numbers('xyy'), numbers("xxx"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_3_14 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!