• Creator: Jade
• Population: 0
• Generation: 4
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 12/05/2019
• Genome: AGAACCCTCAACCTTTATAAACCATTCTGG
• Function:

  sin(10 *(min(square(round(numbers("yxx"), numbers("xxx"))), round(numbers("yxx"), numbers("xxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.