header

genetic-algorithms.com

 

Inspect Jade_0_6_9

Parents

Mother

Image 01

Jade_0_5_15

Genome: TAATTAAGCTGAAGCTGATATAAGTGTTTTAAT

Father

Image 01

Jade_0_5_4

Genome: ATAGCGGCAGGTGTAGCAAGCCCTTCGCATTGT

Jade_0_6_9

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 6
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/05/2019
  • Genome: TAATTATGCTGAAGAGCAAATGAGTGTTTTGAT
  • Function:

    sin(numbers("yxx") if numbers('ryy') > numbers("xyx") else numbers('rrr')) if numbers("xyx") if numbers('ryy') > numbers("yxx") else numbers('rrr') if sin(numbers("yxx") if numbers('rrr') > numbers("xyx") else numbers('ryy')) > numbers("yxx") else numbers("xyx") if numbers("yxx") if numbers("xyx") > numbers('rrr') else numbers('ryy') if numbers("yxx") > sin(numbers('ryy') if numbers("xyx") > numbers("yxx") else numbers('rrr')) else numbers("xyx") if numbers('ryy') if numbers('rrr') > numbers("xyx") else numbers("yxx") > sin(numbers('rrr') if numbers("xyx") > numbers('ryy') else numbers("yxx")) else numbers("yxx") > numbers("yxx") if numbers('rrr') > numbers("xyx") else numbers('ryy') else sin(numbers("xyx") if numbers('ryy') > numbers('rrr') else numbers("yxx")) > numbers('ryy') if numbers("yxx") > numbers("xyx") else numbers('rrr') if sin(numbers("xyx") if numbers("yxx") > numbers('rrr') else numbers('ryy')) > numbers("yxx") else numbers('ryy') if numbers('rrr') > numbers("yxx") else numbers("xyx") if numbers("yxx") > numbers("xyx") else sin(numbers("xyx") if numbers('ryy') > numbers("yxx") else numbers('rrr')) else numbers("yxx") if numbers('ryy') if numbers("xyx") > numbers("yxx") else numbers('rrr') > sin(numbers("xyx") if numbers("yxx") > numbers('rrr') else numbers('ryy')) else numbers("xyx")

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_7_20

Image 01

Genome: TAATTATGCGGAAGAGCCTCAAGGAGTTTTGAT

Jade_0_7_25

Image 01

Genome: TCCTCTGGAGTGTTTTAGAATTGCTTGTTTTCA

Jade_0_7_23

Image 01

Genome: GCGAGAAACTGCTGAAGAGCAACCACTATTGAA

Jade_0_7_17

Image 01

Genome: CGTTAATTTCGCGGAAGAGCATGCTTGTTTCCA

Jade_0_7_13

Image 01

Genome: AGAAACTATAAGGTCATTACCAGTTGTTGA

Jade_0_7_0

Image 01

Genome: TACTCTTATACCCTTGCAAATTGTCCAGAC