• Creator: Jade
• Population: 0
• Generation: 6
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 12/05/2019
• Genome: TTAGTGCGCGCAAGGACTGATAAAACCTCTCACAAG
• Function:

  numbers("xxx") if 2 *(numbers("yxx")) > numbers("yxx") else tan(2 *(numbers("yxx"))) if 2 *(numbers("yxx")) if tan(2 *(numbers("yxx"))) if numbers("xxx") > 2 *(numbers("yxx")) else numbers("yxx") > tan(2 *(numbers("yxx"))) else round(numbers("xxx") if tan(2 *(numbers("yxx"))) > 2 *(numbers("yxx")) else numbers("yxx"), tan(2 *(numbers("yxx")))) > round(numbers("yxx") if tan(2 *(numbers("yxx"))) > 2 *(numbers("yxx")) else numbers("xxx"), tan(2 *(numbers("yxx")))) else tan(2 *(numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.