• Creator: Jade
• Population: 0
• Generation: 6
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 12/05/2019
• Genome: AACTAACCCACCCTGAAGAATTGTCCAGAC
• Function:

  square(mean(numbers("xyx"), numbers("yxx")) if 10 *(mean(numbers("xyx"), numbers("yxx"))) > numbers("xyx") else product(10 *(mean(numbers("xyx"), numbers("yxx"))), mean(numbers("xyx"), numbers("yxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.