header

genetic-algorithms.com

 

Inspect Jade_0_7_3

Parents

Mother

Image 01

Jade_0_6_5

Genome: TGACCGAGAGGTATAGTAGTTAAGTCGTGG

Father

Image 01

Jade_0_6_19

Genome: GCGGGACCGAATAGGGACCGTAGTAGGAAAGAG

Jade_0_7_3

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 7
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 12/06/2019
  • Genome: TGACCCAGAGGTATAGTCGTTAAATCGTGG
  • Function:

    product(sin(numbers("xxx") if logn(numbers('rep')) > numbers('rrr') else numbers('rep')), logn(numbers('rep')) if numbers("xxx") > numbers('rrr') else numbers('rep')) if logn(numbers('rep')) > sin(numbers('rep') if numbers("xxx") > numbers('rrr') else logn(numbers('rep'))) else logn(numbers('rep')) if numbers('rep') > numbers("xxx") else numbers('rrr')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_7_3 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!