• Creator: Jade
• Population: 0
• Generation: 7
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 12/06/2019
• Genome: TAGTCTTATACCCTATAGAAGTGTGCAGCC
• Function:

  max(numbers("xyx"), numbers("xyx")) if numbers("xyx") > numbers("xyx") else 10 *(max(numbers("xyx"), numbers("xyx"))) if max(numbers("xyx"), numbers("xyx")) > numbers("xyx") else 10 *(max(numbers("xyx"), numbers("xyx"))) if numbers("xyx") if max(numbers("xyx"), numbers("xyx")) > numbers("xyx") else 10 *(max(numbers("xyx"), numbers("xyx"))) > max(numbers("xyx"), numbers("xyx")) else 10 *(max(numbers("xyx"), numbers("xyx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.