• Creator: Jade
• Population: 0
• Generation: 11
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 12/06/2019
• Genome: GGAATTACGCAAAACCACTGTACTAAACAA
• Function:

  sum(square(numbers("xxy")), numbers("xxy")) if square(numbers("xxy")) > gradient[0](100 *(sum(square(numbers("xxy")), numbers("xxy")))) else 100 *(sum(square(numbers("xxy")), numbers("xxy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.