• Creator: Jade
• Population: 0
• Generation: 12
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/06/2019
• Genome: CGTAACCTTTATACCCTTCCAAGTGCAAGTTAG
• Function:

  log(square(round(numbers("yyy") if numbers('ryy') > 10 *(round(numbers("yyy"), numbers('ryy'))) else round(numbers("yyy"), numbers('ryy')), 10 *(round(numbers("yyy"), numbers('ryy'))))), round(numbers('ryy') if round(numbers("yyy"), numbers('ryy')) > numbers("yyy") else 10 *(round(numbers("yyy"), numbers('ryy'))), 10 *(round(numbers("yyy"), numbers('ryy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.