• Creator: Jade
• Population: 0
• Generation: 13
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 12/06/2019
• Genome: CCCCAACCGAGCACCCTTACGTTTATCTGAGTG
• Function:

  product(sum(divide(cos(10 *(round(numbers('yxy'), numbers('rrr')))), 10 *(round(numbers('yxy'), numbers('rrr')))), cos(10 *(round(numbers('yxy'), numbers('rrr'))))), divide(cos(10 *(round(numbers('yxy'), numbers('rrr')))), 10 *(round(numbers('yxy'), numbers('rrr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.