• Creator: Jade
• Population: 0
• Generation: 16
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 12/06/2019
• Genome: AATAAATAAAGGATTCGGAGACTACGGAAC
• Function:

  noise(abs(numbers('yxr') if numbers("xxr") > gradient[0](numbers('yxr')) else tan(gradient[0](numbers('yxr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.