• Creator: Jade
• Population: 0
• Generation: 18
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/06/2019
• Genome: AATCGTACCGACACCAAACGCAGGCACTAT
• Function:

  noise(log(10 *(numbers("xxx") if 10 *(numbers("xxx")) > numbers('xry') else numbers('yxr')), numbers("xxx") if numbers('xry') > numbers('yxr') else 10 *(numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.