header

genetic-algorithms.com

 

Inspect Jade_0_24_29

Parents

Jade_0_24_29 has no parents. It was generated at random.

Jade_0_24_29

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 24
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 12/06/2019
  • Genome: GAAGCATCGTGACGCTTTGCTGGTAACGCC
  • Function:

    numbers('xyy') if round(numbers('rrr'), numbers('xyy')) > numbers('ryy') else numbers('rrr') if numbers('xyy') > numbers('rrr') else round(numbers('rrr'), numbers('xyy')) if round(numbers('rrr'), numbers('xyy')) > numbers('ryy') if round(numbers('rrr'), numbers('xyy')) > numbers('rrr') else numbers('xyy') else numbers('rrr') if round(numbers('rrr'), numbers('xyy')) if numbers('xyy') > numbers('rrr') else numbers('ryy') > round(numbers('rrr'), numbers('xyy')) else numbers('xyy') if round(numbers('rrr'), numbers('xyy')) > numbers('xyy') if numbers('ryy') > round(numbers('rrr'), numbers('xyy')) else numbers('rrr') else numbers('rrr')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_24_29 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!