• Creator: Jade
• Population: 0
• Generation: 27
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 12/06/2019
• Genome: GCGCCTTGACTCACCTAATAGCCCACGGAG
• Function:

  divide(numbers("xxx") if min(10 *(numbers("xxx")), numbers("xxx")) > numbers("xyx") else 10 *(numbers("xxx")), min(10 *(numbers("xxx")), numbers("xxx"))) if min(10 *(numbers("xxx")), numbers("xxx")) > min(10 *(numbers("xxx")), numbers("xxx")) if 10 *(numbers("xxx")) > numbers("xxx") else numbers("xyx") else 10 *(numbers("xxx"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.