• Creator: Jade
• Population: 0
• Generation: 27
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 12/06/2019
• Genome: AAAAGGTATAAGACTTACATGTTTGGTCAA
• Function:

  abs(tan(numbers("xxy") if numbers('epe') > 2 *(numbers("xxy")) else invert(2 *(numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.