• Creator: Jade
• Population: 0
• Generation: 30
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 12/06/2019
• Genome: GTTCACCAAAAGACAAGGTCTCGGATACGCCAGAAG
• Function:

  gradient[2](tan(numbers('xyy'))) if sum(invert(gradient[2](tan(numbers('xyy')))), gradient[2](tan(numbers('xyy')))) > invert(gradient[2](tan(numbers('xyy')))) else sum(sum(invert(gradient[2](tan(numbers('xyy')))), gradient[2](tan(numbers('xyy')))), invert(gradient[2](tan(numbers('xyy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.