• Creator: Jade
• Population: 0
• Generation: 32
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/06/2019
• Genome: TATCACCAAGAGACAAGGTCGTAGACTGGAAATGCG
• Function:

  sum(gradient[2](tan(numbers('yxy'))) if numbers("xyx") > tan(numbers('yxy')) else numbers('yxy'), gradient[2](tan(numbers('yxy')))) if tan(numbers('yxy')) if numbers('yxy') > gradient[2](tan(numbers('yxy'))) else numbers("xyx") > sum(sum(tan(numbers('yxy')) if gradient[2](tan(numbers('yxy'))) > numbers("xyx") else numbers('yxy'), gradient[2](tan(numbers('yxy')))), numbers('yxy') if tan(numbers('yxy')) > numbers("xyx") else gradient[2](tan(numbers('yxy')))) else gradient[2](tan(numbers('yxy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.