• Creator: Jade
• Population: 0
• Generation: 35
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 12/06/2019
• Genome: CCGTCATGAACTACGGCGGAGTTGCGCATC
• Function:

  divide(100 *(numbers('yxy')) if 2 *(100 *(numbers('yxy'))) if numbers('yxy') > 100 *(numbers('yxy')) else numbers("xyx") > numbers('yxy') else 2 *(100 *(numbers('yxy'))), 2 *(100 *(numbers('yxy'))) if numbers("xyx") > numbers('yxy') else 100 *(numbers('yxy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.