• Creator: guest15120
• Population: 0
• Generation: 0
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 12/12/2024
• Genome: AGACCGCGGCCGAGCAACGACACCCTTGAA
• Function:

  sin(divide(exp(divide(cos(numbers("xxy")), numbers("xxy")), cos(numbers("xxy"))), divide(cos(numbers("xxy")), numbers("xxy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.