• Creator: guest15120
• Population: 0
• Generation: 1
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 12/12/2024
• Genome: GCTGGGTAACTGACGACCAAGCCATCAAGG
• Function:

  mean(100 *(numbers('yyx')), numbers('yyx')) if 100 *(numbers('yyx')) if mean(100 *(numbers('yyx')), numbers('yyx')) > numbers('yyx') else mean(100 *(numbers('yyx')), numbers('yyx')) if 100 *(numbers('yyx')) > numbers("xyx") else numbers('yyx') > 100 *(numbers('yyx')) if mean(100 *(numbers('yyx')), numbers('yyx')) > numbers('yyx') else numbers("xyx") else 100 *(numbers('yyx'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.