• Creator: guest15120
• Population: 0
• Generation: 2
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 12/12/2024
• Genome: GGCATTGGTACGCGCCACCATCATCGGAGT
• Function:

  round(numbers("xxy"), numbers("yxx")) if numbers("yxx") > 100 *(round(numbers("xxy"), numbers("yxx"))) else numbers("xxy") if round(numbers("xxy"), numbers("yxx")) > gradient[0](round(numbers("xxy"), numbers("yxx")) if numbers("yxx") > 100 *(round(numbers("xxy"), numbers("yxx"))) else numbers("xxy")) else 100 *(round(numbers("xxy"), numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.