header

genetic-algorithms.com

 

Inspect guest15120_0_5_20

Parents

Mother

Image 01

guest15120_0_4_6

Genome: ATCCGGCACGTTAGGACACGTGATCCAAGG

Father

Image 01

guest15120_0_4_18

Genome: ATTCCGCACGGTAGGACAGGGCAGGTTTGG

guest15120_0_5_20

Image 01

  • Creator: guest15120
  • Population: 0
  • Generation: 5
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 12/12/2024
  • Genome: ATCCGGCACGTTAGGGCACGTGATCCATGG
  • Function:

    band pass(exp(sum(tan(numbers("yyy")) if numbers("yxx") > numbers('ryy') else numbers("yyy"), tan(numbers("yyy"))), numbers("yxx") if numbers("yyy") > numbers('ryy') else tan(numbers("yyy"))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest15120_0_6_23

Image 01

Genome: ATCCGGCACGTTCCCAACTACTGCTACCGG