• Creator: Jade
• Population: 0
• Generation: 49
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 12/06/2019
• Genome: AATTAGTAAACTAAGGCTAGCAAGCCTCCC
• Function:

  noise(numbers('xyy') if numbers('xry') > 2 *(invert(numbers('xyy'))) else invert(numbers('xyy')) if numbers('xyy') > invert(numbers('xyy')) else 2 *(invert(numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.