• Creator: guest15817
• Population: 0
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 03/27/2025
• Genome: ATGAGTACACCCAAAAACAACGGGGCGTGC
• Function:

  sqrt(gradient[1](gradient[2](product(abs(numbers("xxy")), numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.