• Creator: guest15817
• Population: 0
• Generation: 0
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 03/27/2025
• Genome: CCCAGCACGCGTAACAGCATAGGTCCCCAA
• Function:

  product(cos(100 *(log(square(numbers('xry')), numbers('xry')))), 100 *(log(square(numbers('xry')), numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.